rs9795177 chr11:112584839 C>G
- Sequence
gtggcaagcagtgggagggctcaa[C/G]ttctggcccctcaccccctctgct
- ASB in cell types
- PC9 (lung adenocarcinoma) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 0.19 | 2.00 | 1.22 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.47 | -0.06 | 1.00 |
Items per page:
1 – 2 of 2