rs979528 chr10:45008946 T>G
- Sequence
gaattcagatttttaattattttt[T/G]ggaatatttgtatgtacatgatga
- ASB in cell types
- foreskin keratinocyte thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.83 | 2.50 | |||
| thyroid gland | 0.04 | 1.81 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid