rs979614 chr6:20661892 A>G
- Sequence
attgaaatacttacataattaaat[A/G]tatgtgttggctgttgtcctaaca
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) foreskin keratinocyte
- ASB for transcription factors
- TCF21_HUMAN P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.49 | n/a | 2.00 | n/a | No Hit | |||
| P63_HUMAN | 0.17 | 1.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, birth weight, fasting blood glucose, ldl cholesterol, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease, type 2 diabetes, waist hip ratio, years of education