rs979862 chr5:76691291 T>C
- Sequence
cagcaactcttgagcaaataaaca[T/C]tctttgtctttggtggggcacgtt
- ASB in cell types
- SUP-B15 (Childhood B acute lymphoblastic leukemia) ZR-75-1 (invasive ductal carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUP-B15 (Childhood B acute lymphoblastic leukemia) | 1.73 | -1.73 | 1.00 | |||
| ZR-75-1 (invasive ductal carcinoma) | 0.25 | 1.28 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 1.34 | -3.83 | 2.00 |
Items per page:
1 – 3 of 3