rs9803654 chr1:81242083 C>G
- Sequence
aaattcatatgcacaacatatttg[C/G]gtgttgctattcctttaagcattg
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.86 | -1.15 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol, triglycerides change with statins