rs9803977 chr1:185406834 G>T
- Sequence
acctagcttacaaatcccctagtg[G/T]caaagggggatttgtacaaatttc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- TF65_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | n/a | 3.00 | 3.00 | n/a | No Hit | |||
| STAT1_HUMAN | -1.66 | 2.46 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), comorbid depressive syndrome and alcohol dependence, fasting blood glucose, hip bone mineral density (bmd), homa-b, irritible bowel syndrome, ldl cholesterol, schizophrenia