rs9804584 chr11:87463478 A>C
- Sequence
tgcattgggccattctccgtgacc[A/C]cttcttattacagtggcttgtcct
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 1.67 | -1.71 | 1.00 | |||
| GM02630 (Fanconi anemi) | -0.92 | 1.44 | 1.00 |
Items per page:
1 – 2 of 2