rs9805471 chr13:25005316 A>C
- Sequence
aaataaaacatctgggccaaaaga[A/C]tagtagttttctgttcctcataac
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) TTC-1240 (Rhabdoid tumor of the kidney) MS-1 (Small cell lung carcinoma) LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.62 | -0.73 | 1.38 | n/a | No Hit | |||
| STAG1_HUMAN | 1.26 | -0.66 | 1.20 | n/a | n/a |
Items per page:
1 – 2 of 2