rs9806121 chr15:60299950 C>G
- Sequence
gtggaggagtcaagccattgcgaa[C/G]cagtttcttacatttcgctgagga
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.21 | -0.90 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1