rs9806383 chr15:62119315 A>G
- Sequence
gggaaaaccctttcatcctgctca[A/G]ctaaagtttcactttccacacaat
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) CD14+ monocytes
- ASB for transcription factors
- TF65_HUMAN O43245_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.64 | -0.97 | 4.00 | n/a | No Hit | |||
| O43245_HUMAN | -0.83 | 2.14 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.24 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, hdl cholesterol change with statins, salmonella-induced pyroptosis, suicide attempts in bipolar disorder (substance abuse/dependence), systolic blood pressure (sbp)