rs9807819 chr19:45736340 C>T
- Sequence
gaattactaagccaccacgcccaa[C/T]tgacattctgagtgtctttctttc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC2_HUMAN NCOR1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC2_HUMAN | 2.49 | -0.87 | 2.00 | n/a | n/a | |||
| NCOR1_HUMAN | 1.87 | -1.03 | 2.00 | n/a | n/a | |||
| SMCA4_HUMAN | 2.05 | -3.78 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), fasting blood glucose, height, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid