rs9808651 chr21:39094542 G>A
- Sequence
gtgcaagtcatttctcaaagcagt[G/A]tctgttcttttctttaatggaatt
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | n/a | 2.79 | 2.00 | |||
| macrophages form periferal blood | 1.64 | -4.61 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, coronary artery disease (cad), fasting insulin, homa-b, homa-ir, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol
Finemapping ankylosing spondylitis, c reactive protein, primary sclerosing cholangitis, ulcerative colitis