rs9809803 chr3:157785302 A>G
- Sequence
ggtatttatgtgatctccggagtc[A/G]gcagaaagcctgccctcagaacaa
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- MAFK_HUMAN GCR_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | 3.15 | 0.81 | 1.50 | -4.14 | Concordant | |||
| GCR_HUMAN | 0.83 | 1.04 | 1.15 | n/a | No Hit | |||
| TF65_HUMAN | 0.26 | 1.54 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, height, ldl cholesterol change with statins, simpson-angus scale, total cholesterol change with statins, triglycerides change with statins