rs980988 chr4:53378271 G>T
- Sequence
ttttctgtcgattctgaggtggtg[G/T]tttttggtgtctgtttttgccctg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.88 | -0.17 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1