rs9811949 chr3:66990119 C>T
- Sequence
aatcacccttggggagaatccctg[C/T]aataaattgttttggtttattttc
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.27 | 2.03 | 1.17 |
Items per page:
1 – 1 of 1