rs9812067 chr3:117875794 T>C
- Sequence
tttctgcctatgtaagtgagactt[T/C]tactttgcttcagagcactgatcc
- ASB in cell types
- A549 (lung carcinoma) CFPAC-1(pancreatic ductal adenocarcinoma) pancreatic ductal adenocarcinoma
- ASB for transcription factors
- GCR_HUMAN FOXA1_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.00 | 0.46 | 1.83 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.44 | -0.31 | 1.17 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.21 | -0.57 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), cystatin c in serum, height, obesity (body mass index (bmi))