rs9812611 chr3:198080324 G>A
- Sequence
gctgagcccccgctacctgtcctg[G/A]gcatccacgtcccggcacctgcgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCFL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCFL_HUMAN | -0.70 | 2.95 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1