rs9813229 chr3:56707557 A>G
- Sequence
gccagtaatcccagctactcggga[A/G]gctgaggcaggagaatcacttgaa
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) MS-1 (Small cell lung carcinoma) VCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.23 | 0.47 | 1.12 | n/a | No Hit | |||
| STAG1_HUMAN | 1.62 | -0.18 | 1.00 | n/a | n/a | |||
| RAD21_HUMAN | 2.13 | -0.42 | 1.11 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood