rs981583 chr1:92105738 T>A
- Sequence
tgagtttatatgaacaaagaacaa[T/A]tcatgaatcatgcagcactcagaa
- ASB for transcription factors
- ZN549_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN549_HUMAN | 1.99 | n/a | 2.00 | -3.61 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), rheumatoid arthritis, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid