rs9819205 chr3:68514965 A>T
- Sequence
caggatgattcttcagaataaaca[A/T]gagatgtaataaaatggctattgt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -2.32 | 2.77 | 2.00 | -0.24 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP body mass index (bmi), obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio