rs9820358 chr3:72186478 C>T
- Sequence
gtctggctggcctgggaaggctct[C/T]agccatccatgaagaagcctacaa
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | 1.37 | 0.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), eye color, ldl cholesterol change with statins, variant creutzfeldt-jakob disease