rs9820851 chr3:72317134 G>A
- Sequence
ggtgctctggccacagttcagcca[G/A]agtgtcagccccagccagatcaac
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.06 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP blood pressure response to candesartan treatment, college completion, diastolic blood pressure (dbp), irritible bowel syndrome, systolic blood pressure (sbp), years of education