rs9821556 chr3:180759429 C>T
- Sequence
aaatataaaggagcaaagaacaca[C/T]acctcatagagaaacaaagcaaac
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | n/a | 1.71 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Ovary, Spleen, Testis