rs982171 chr8:103479608 G>A
- Sequence
ataatgactcattcttgggccaag[G/A]cttaggagcctggtttgaacttct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.34 | 0.93 | 1.39 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, fasting insulin, hdl cholesterol, homa-b, homa-ir, infant head circumference, mitral annular calcium, years of education
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Pituitary, Testis, Thyroid