rs9822311 chr3:115819804 G>C
- Sequence
tgtgaaatcctaaagatcttaaca[G/C]ttgggattccatttttctttagga
- ASB in cell types
- VCaP (prostate carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | n/a | 1.15 | 2.00 | |||
| A549 (lung carcinoma) | 0.83 | 0.01 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol