rs9823407 chr3:36701188 T>C
- Sequence
aggctgtgcaaagcctggtttgtc[T/C]ttcctttctcttcaacatcaacaa
- ASB in cell types
- T47D (invasive ductal carcinoma) erythroid progenitors thyroid gland THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.22 | 1.46 | 2.00 | |||
| erythroid progenitors | 2.47 | -4.70 | 2.00 | |||
| thyroid gland | 1.27 | -1.27 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.99 | 1.06 | 1.00 | |||
| epidermal keratinocytes | 1.71 | -0.37 | 2.00 |
Items per page:
1 – 5 of 5