rs9825174 chr3:195118855 C>T
- Sequence
aggtgacgtagtaaactttcgaaa[C/T]gtagttccctgaaggaggaatctt
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC3(bone mets prostate adenocarcinoma) | n/a | 2.46 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), obesity with early age of onset (age >2)
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic