rs9825362 chr3:102692907 G>A
- Sequence
tccagttcattgagggcatgtcca[G/A]gcaagaccctgtgcaggctcccaa
- ASB in cell types
- SJSA-1(osteosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SJSA-1(osteosarcoma) | 2.33 | -4.06 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins, waist hip ratio