rs9827043 chr3:189621708 G>T
- Sequence
tactcagggtcttgatctggaaaa[G/T]aaggatttttttttactttgaaaa
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -1.74 | 2.53 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, homa-b, microalbuminuria, systolic blood pressure (sbp)