rs9827402 chr3:125519775 C>A
- Sequence
gcgcccccccgggtccctttccct[C/A]cccttcgcagtctcgacacttccc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.86 | -0.40 | 1.33 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.24 | -0.69 | 1.00 |
Items per page:
1 – 2 of 2