rs9827866 chr3:98555135 T>C
- Sequence
acaccagtttctccaacatcaaag[T/C]ttccttttccaccaccttaattcg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.47 | 0.94 | 1.05 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.58 | -2.66 | 1.50 |
Items per page:
1 – 2 of 2