rs9828542 chr3:14780956 T>C
- Sequence
cctgccgtgtattcccaaatgatt[T/C]cccttccttctgggcacacagccc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -0.77 | 0.83 | 1.00 | |||
| H929 (plasma cell myeloma) | 2.27 | -1.79 | 1.00 |
Items per page:
1 – 2 of 2