rs9828560 chr3:14780981 T>G
- Sequence
cccttccttctgggcacacagccc[T/G]gttacacttcccattctcccatgg
- ASB in cell types
- T47D (invasive ductal carcinoma) GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.43 | -0.29 | 2.09 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.49 | 0.60 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.88 | 0.43 | 1.05 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, comorbid depressive syndrome and alcohol dependence, total cholesterol