rs9833254 chr3:175686117 T>C
- Sequence
gtctaatggttcctcatccatgaa[T/C]cctattaaaaactgatttaaaaat
- ASB in cell types
- breast tumor MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.40 | -0.78 | 2.00 | |||
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | 1.65 | -0.11 | 2.80 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hip bone mineral density (bmd), neuroblastoma (brain cancer), tetrology of fallot, variant creutzfeldt-jakob disease