rs9833297 chr3:62659910 G>T
- Sequence
ctcatagaaaccctcaatacccta[G/T]acagggaccctccatatatactga
- ASB in cell types
- neural cell HEK293 (embryonic kidney) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.96 | 1.79 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.09 | 1.68 | 1.44 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.55 | -1.31 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -1.35 | 1.67 | 1.00 |
Items per page:
1 – 4 of 4