rs9834159 chr3:188397444 T>A
- Sequence
tgactgatagaaactgtggcaaac[T/A]aaaggccacttagtcagtatttgt
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.58 | 1.57 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, blood pressure response to candesartan treatment, body mass index (bmi), diastolic blood pressure (dbp), fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir