rs9834883 chr3:98185403 T>G
- Sequence
atctaaggtccttggaagaacagc[T/G]tgtccttgtgttgtttagtttgca
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -0.13 | 2.29 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.78 | -3.24 | 1.50 | |||
| RWPE2 | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 3 of 3