rs9834993 chr3:98185412 T>C
- Sequence
ccttggaagaacagcttgtccttg[T/C]gttgtttagtttgcagcaccatct
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.78 | -3.24 | 1.50 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.10 | 2.23 | 1.00 | |||
| GM02630 (Fanconi anemi) | -1.54 | 1.66 | 1.33 | |||
| RWPE2 | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 4 of 4