rs9835876 chr3:194527565 G>A
- Sequence
gctcattgcaacccctgcctcctg[G/A]gttcaagctattctcctgcctcag
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | -0.80 | 1.81 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Testis, Thyroid, Whole_Blood