rs9837165 chr3:27582183 G>A
- Sequence
gctggagtgcaatggcgtgatctc[G/A]gctcactgcaaactctgcctccca
- ASB in cell types
- 22RV1 (prostate carcinoma) LNCaP (prostate carcinoma) LNCaP C4-2 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.22 | -0.61 | 2.00 | |||
| LNCaP (prostate carcinoma) | -0.41 | 1.59 | 1.50 | |||
| LNCaP C4-2 (prostate carcinoma) | -1.42 | 2.45 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg