rs9837335 chr3:107927960 G>T
- Sequence
acactgcagcctcgcgggctgccc[G/T]ggacttcatcaagcccgggtcggc
- ASB in cell types
- uterus
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| uterus | 2.17 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, ldl cholesterol change with statins, partial epilepsy, total cholesterol, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Testis, Whole_Blood