rs9837453 chr3:70072546 G>T
- Sequence
aaaatctcctcctgaccacggaga[G/T]aagaggggattttagaataaagat
- ASB in cell types
- SUP-B15 (Childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.94 | 0.39 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1