rs9838306 chr3:142931449 C>A
- Sequence
caccaggtgcaagacacaacagga[C/A]cactgggggcacgctggcttgata
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines) epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.18 | -0.05 | 1.77 | n/a | No Hit | |||
| STAG1_HUMAN | 4.16 | -2.26 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Nucleus_accumbens_basal_ganglia, Heart_Left_Ventricle, Liver, Testis