rs9838793 chr3:79564557 A>C
- Sequence
ttatcaacaaggagatattttatg[A/C]attgaatgtgggtgaacttaatga
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 1.09 | -0.47 | 1.69 |
Items per page:
1 – 1 of 1