rs9839660 chr3:14989038 T>A
- Sequence
ggcttttgttttgtttttgctgat[T/A]ggtcagcattcacttcatatcagt
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 2.47 | n/a | 3.00 | -4.87 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP childhood acute lymphoblastic leukemia, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach