rs9839909 chr3:171790673 T>C
- Sequence
caaaggaagctggcatgctcctct[T/C]cctctattctctgtctgtaatgta
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.29 | 0.70 | 1.43 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, ldl cholesterol change with statins, renal cell carcinoma (renal cancer), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Lung, Muscle_Skeletal, Spleen, Thyroid, Whole_Blood