rs9841319 chr3:170690465 G>A
- Sequence
ttcccccttgttctgggctctgtg[G/A]gcaggagagtgggaaaaataaaaa
- ASB in cell types
- T47D (invasive ductal carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -0.97 | 2.48 | 3.40 | |||
| HEK293 (embryonic kidney) | -0.04 | 1.11 | 1.50 |
Items per page:
1 – 2 of 2