rs9843561 chr3:31462317 C>A
- Sequence
atgaggcaagagtctcagcagcaa[C/A]agcagtggtagccatggacaaatg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) GM17942 (lymphoblastoid cell) iPS-derived dermal fibroblasts
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.33 | 0.38 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1