rs9843918 chr3:105504919 A>T
- Sequence
tttaaagggaccacgctcttccct[A/T]cccagcacttcccttccatatcac
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.75 | -0.13 | 1.67 | 1.10 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
