rs9844915 chr3:186487940 T>C
- Sequence
ctttgtactaactggttgtatgac[T/C]tacaggcaggccctttaggcacag
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.07 | 2.10 | 1.00 | |||
| iPS-derived dermal fibroblasts | 2.06 | -0.91 | 1.00 |
Items per page:
1 – 2 of 2